[Django]-Generate a Unique String in Python/Django

From 3.6 You can use secrets module to generate nice random strings.
https://docs.python.org/3/library/secrets.html#module-secrets

import secrets
print(secrets.token_hex(5))

A more secure and shorter way of doing is using Django’s crypto module.

from django.utils.crypto import get_random_string
code = get_random_string(5)

get_random_string() function returns a securely generated random string, uses
secrets module under the hood.

You can also pass allowed_chars:

from django.utils.crypto import get_random_string
import string

code = get_random_string(5, allowed_chars=string.ascii_uppercase + string.digits)

Am not sure about any short cryptic ways, but it can be implemented using a simple straight forward function assuming that you save all the generated strings in a set:

import random

def generate(unique):
    chars = "ABCDEFGHIJKLMNOPQRSTUVWXYZ1234567890"
    while True:
        value = "".join(random.choice(chars) for _ in range(5))
        if value not in unique:
            unique.add(value)
            break

unique = set()
for _ in range(10):
    generate(unique)

If you can afford to lose ‘8’ and ‘9’ in the generated numbers there is a very pythonic solution to getting a random number.

import os
import base64

base64.b32encode(os.urandom(3))[:5].decode('utf-8')

Since you are going for uniqueness then you have a problem since 36 * 36 * 36 * 36 * 36 = 60'466'176 which will definitely result in collisions if you have millions. Since sets are faster than dicts we do…

some_set = set()

def generate():
    return base64.b32encode(os.urandom(3))[:5].decode('utf-8')

def generate_unique():
    string = generate()
    while string in some_set:
        string = generate()
    some_set.add(string)
    return string

However since uniqueness is usually more important I’d recommend generating a unique code for each of the numbers from 0 to 36^5 - 1 like this. We can use a large prime and modulo to make a psuedo-random number like this.

import base64
import math

num = 1
prime_number = 60466181
characters = 'ABCDEFGHIJKLMNOPQRSTUVWXYZ123456789'

def num_to_code(n: int):
    string = ''
    hashed = hash_number(n)
    for x in range(5):
        charnumber = hashed % 36
        hashed = math.floor(hashed / 36)
        string += characters[charnumber]
    return string

def hash_number(n: int, rounds = 20):
    if rounds <= 0:
        return n
    hashed = (n * prime_number) % (36 ** 5)
    return hash_number(hashed, rounds - 1)

if __name__ == '__main__':
    code = num_to_code(1)
    print(code)

Here are the results from generating 0-5, they’ll always generate the same sequence.

0 AAAAA (easily fixable ofc)
1 ZGQR9
2 ON797
3 DUMQ6
4 31384
5 R8IP3

If you have a way of associating each user to a unique ID (for example Primary Key in Django or Flask). You can do something like this:

Note: This does not generate a fixed length.

We will pad the user_id to the right to make the generated length a bit static

import os
import base64

user_id = 1

#pad the string
number_generate = str(user_id).rjust(5,"0")

base64.b32encode(bytes(number_generate, 'utf-8')).decode('utf-8').replace('=','')

size = 5
''.join(random.choice(string.letters[26:] + string.digits) for in range(size))

this will generate some short code, but they can be duplicated. so check if they are unique in your database before saving.

def generate(size=5):
    code = ''.join(random.choice(string.letters[26:] + string.digits) for in range(size))
    if check_if_duplicate(code):
        return generate(size=5)
    return code

or using django unique constrain, and handle exceptions.

There is a function in django that does what you’re looking for (credits to this answer):

Django provides the function get_random_string() which will satisfy
the alphanumeric string generation requirement. You don’t need any
extra package because it’s in the django.utils.crypto module.

>>> from django.utils.crypto import get_random_string
>>> unique_id = get_random_string(length=32)
>>> unique_id
u'rRXVe68NO7m3mHoBS488KdHaqQPD6Ofv'

You can also vary the set of characters with allowed_chars:

>>> short_genome = get_random_string(length=32, allowed_chars='ACTG')
>>> short_genome
u'CCCAAAAGTACGTCCGGCATTTGTCCACCCCT'

I have a unique field, named ‘systemCode‘ within a lot of my models. And I am generating this manually, but also sometimes it can take value from user input, so I have to check this value before saving and if it matches , regenerating this value as a unique value.

And this is how I generate unique strings at this scenario :

This is my standard class Model :

class ClassOne(models.Model):
   name = models.CharField(max_length=100)
   systemCode = models.CharField(max_length=25, blank=True, null=True, unique=True)
   ....

I am using save() method to generate and check this systemCode is unique :

    def save(self, *args, **kwargs):
        systemCode = self.systemCode
        if not systemCode:
            systemCode = uuid.uuid4().hex[:6].upper()
        while ClassOne.objects.filter(systemCode=systemCode).exclude(pk=self.pk).exists():
            systemCode = uuid.uuid4().hex[:6].upper()
        self.systemCode = systemCode
        super(ClassOne, self).save(*args, **kwargs)

But I have same systemCode field in all my Models. So I am using a function to generate value.

So, this is how to generate unique value for all models using saveSystemCode() function :

import uuid 

def saveSystemCode(inClass, inCode, inPK, prefix):
    systemCode = inCode
    if not systemCode:
        systemCode = uuid.uuid4().hex[:6].upper()

    while inClass.objects.filter(systemCode=systemCode).exclude(pk=inPK).exists():
        systemCode = uuid.uuid4().hex[:6].upper()

    return systemCode

class ClassOne(models.Model):
    name = models.CharField(max_length=100)
    systemCode = models.CharField(max_length=25, blank=True, null=True, unique=True)
    ....

    def save(self, *args, **kwargs):
        self.systemCode = saveSystemCode(ClassOne, self.systemCode, self.pk, 'one_')
        super(ClassOne, self).save(*args, **kwargs)


class ClassTwo(models.Model):
    name = models.CharField(max_length=100)
    systemCode = models.CharField(max_length=25, blank=True, null=True, unique=True)
    ....

    def save(self, *args, **kwargs):
        self.systemCode = saveSystemCode(ClassTwo, self.systemCode, self.pk, 'two_')
        super(ClassTwo, self).save(*args, **kwargs)

class ClassThree(models.Model):
    name = models.CharField(max_length=100)
    systemCode = models.CharField(max_length=25, blank=True, null=True, unique=True)
    ....

    def save(self, *args, **kwargs):
        self.systemCode = saveSystemCode(ClassThree, self.systemCode, self.pk, 'three_')
        super(ClassThree, self).save(*args, **kwargs)

while loop in the ‘saveSystemCode‘ function is preventing to save same value again.

To generate unique one you can use below command:

import uuid 
str(uuid.uuid1())[:5]

Here a solution to gen codes of lenght 5 or any on a file:

import shortuuid as su
n = int(input("# codes to gen: "))
l = int(input("code lenght: "))
shou = su.ShortUUID(alphabet="QWERTYUIOPASDFGHJKLZXCVBNM0123456789")
codes = set()
LEN_CNT = 0

with open('file.txt', 'w') as file:
    while len(codes) < n:
        cd = shou.random(length=l)
        codes.add(cd)
        if len(codes) > LEN_CNT:
            LEN_CNT = len(codes)
            file.write(f"{cd}\n")

(shortuuid sometimes gen duplicated codes, so I use a set to deal with that)

As the time of writing this answer, there is an actively maintained package that generates short UUIDs:

https://github.com/skorokithakis/shortuuid

For Django support, have a look here:

https://github.com/skorokithakis/shortuuid#django-field